Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Circular RNA ARHGAP26 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 30719998 |
Experimental Method | |||
Sample Type | Cell Lines | Comparison | Human GC cell lines including HGC-27, AGS, SGC-7901, BGC-823, NCI-N87 and human normal gastric mucosal cells GSE-1 were purchased |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward AACAGACTCCATTGAGAAGAGGTT ReverseGCCTCCTGAAGCTGAGATTCTT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Wangxia, LV, Fang, Y, Liu, Y, Zhao, Y, Shi, Z, Zhong, H (2019). Circular RNA ARHGAP26 is over-expressed and its downregulation inhibits cell proliferation and promotes cell apoptosis in gastric cancer cells. Saudi J Gastroenterol, 25, 2:119-125. |